Copyright©2018 CSIR-Institute of Genomics and Integrative Biology | VS Lab |
cANRIL | |||
Gene | ANRIL | Organism | Rat |
Genome Locus | n/a | Build | n/a |
Disease | Atherosclerosis | ICD-10 | Atherosclerosis (I70) |
DBLink | Link to database | PMID | 28683453 |
Experimental Method | |||
Sample Type | Blood samples | Comparison | Sixty Wistar rats were randomly assigned into control, model, empty vector, over-expressed cANRIL and low-expressed cANRIL groups (12 rats in each group). |
Method for Estimation | Quantitative PCR | PCR Details | |
Primers (Experimented) | Forward TGCTCTATCCGCCAATCAGG ReverseGGGCCTCAGTGGCACATACC | Statistics | Fold Change : Upregulated pvalue : p<0.05 |
Citation | |||
Song, CL, Wang, JP, Xue, X, Liu, N, Zhang, XH, Zhao, Z, Liu, JG, Zhang, CP, Piao, ZH, Liu, Y, Yang, YB (2017). Effect of Circular ANRIL on the Inflammatory Response of Vascular Endothelial Cells in a Rat Model of Coronary Atherosclerosis. Cell. Physiol. Biochem., 42, 3:1202-1212. |